Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.130413 |
Chromosome: | chromosome 16 |
Location: | 5382682 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g681500 | (1 of 1) K07002 - uncharacterized protein (K07002) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGCATCCCAGTCTAAGTGGCTCCCTTTCA |
Internal bar code: | GTGCTGGCGCTTTAGCGCATCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 692 |
LEAP-Seq percent confirming: | 87.687 |
LEAP-Seq n confirming: | 16351 |
LEAP-Seq n nonconfirming: | 2296 |
LEAP-Seq n unique pos: | 71 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGGTGTTGGGTGAAGTCAGG |
Suggested primer 2: | ACACACACACACACACACGG |