Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.130463 |
Chromosome: | chromosome 7 |
Location: | 4570284 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g343933 | EBM6 | (1 of 4) K19355 - mannan endo-1,4-beta-mannosidase (MAN); Mannan endo-1%252C4-beta-mannosidase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCCCCCCTTGCACACACATTGGATTCAAC |
Internal bar code: | CCGGCATCGTTCAGTTTGACAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 442 |
LEAP-Seq percent confirming: | 93.6015 |
LEAP-Seq n confirming: | 512 |
LEAP-Seq n nonconfirming: | 35 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTTTTACAGCCCTTTGCTGC |
Suggested primer 2: | GGTGGTGGCATCAGTGGTAT |