Insertion junction: LMJ.RY0402.130486_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.130486
Chromosome:chromosome_9
Location:167856
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre09.g386736 FAP44 Flagellar Associated Protein sense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):CTGGAGAAGGGTCTGGCGGCCTACAACCGG
Internal bar code:ACGCCATGGCGGGCTGTCGGGGA

Confirmation - LEAP-Seq

LEAP-Seq distance:807
LEAP-Seq percent confirming:82.9504
LEAP-Seq n confirming:686
LEAP-Seq n nonconfirming:141
LEAP-Seq n unique pos:5

Suggested primers for confirmation by PCR

Suggested primer 1:TCAAGTCCGACCCCAACTAC
Suggested primer 2:GCCTAGTTCCATCCTGACCA