| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.130502 |
| Chromosome: | chromosome 2 |
| Location: | 1250273 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g082550 | ZEP,ZEP1 | Zeaxanthin epoxidase 1; (1 of 1) K09838 - zeaxanthin epoxidase (ZEP, ABA1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGGGCGAGGGTCATGAACGCGAGTGGCGA |
| Internal bar code: | AAGGCGAGCTCACGGGGCGCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 514 |
| LEAP-Seq percent confirming: | 99.6571 |
| LEAP-Seq n confirming: | 872 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCAAGGTGAAGATGCAGCAC |
| Suggested primer 2: | CTGTAATTGCGTGTTGGTGG |