Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.130503 |
Chromosome: | chromosome 8 |
Location: | 3840037 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g377600 | ATG14 | AuTophaGy related; (1 of 1) PF10186 - Vacuolar sorting 38 and autophagy-related subunit 14 (Atg14) | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATAATCTGCTCCCGCGCTACTCGCAGTTG |
Internal bar code: | GTTAGGCGACACCCATTGCCAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 745 |
LEAP-Seq percent confirming: | 99.6183 |
LEAP-Seq n confirming: | 3132 |
LEAP-Seq n nonconfirming: | 12 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGAGCTTGGTTTGTCTGTGC |
Suggested primer 2: | CAATTCCATTGCTCGTTGTG |