| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.130581 |
| Chromosome: | chromosome 2 |
| Location: | 2522749 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g092350 | CYP51G1,CYP6 | (1 of 1) 1.14.13.70 - Sterol 14-alpha-demethylase / Obtusufoliol 14-demethylase; Cytochrome P450, CYP51 superfamily | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACAGCCCCCCAAAGGCAAGCAGCTGGCAAA |
| Internal bar code: | TGAGACGCTCAGAGAAGGGAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 203 |
| LEAP-Seq percent confirming: | 1.65824 |
| LEAP-Seq n confirming: | 82 |
| LEAP-Seq n nonconfirming: | 4863 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGTTGGCGGTATCAAAGAC |
| Suggested primer 2: | ATGGGTAACGCAAGACAAGG |