| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.130644 |
| Chromosome: | chromosome 7 |
| Location: | 4799705 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g345700 | COQ10 | Coenzyme Q-binding protein; (1 of 1) K18588 - coenzyme Q-binding protein COQ10 (COQ10) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCTGGTACATGCCGTTTTGCACATACACA |
| Internal bar code: | GTGACAGTTCATCCTAATGATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1061 |
| LEAP-Seq percent confirming: | 98.9633 |
| LEAP-Seq n confirming: | 10119 |
| LEAP-Seq n nonconfirming: | 106 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACACGCATACACATACGCA |
| Suggested primer 2: | CGAGCACCGATTCAGGTATT |