| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.130657 |
| Chromosome: | chromosome 10 |
| Location: | 3065518 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g441550 | MAM3B | (1 of 5) K16302 - metal transporter CNNM (CNNM); Protein putatively involved in mitochondrial biogenesis | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCACCGGCGCATCACGGCGGCAGCACTGC |
| Internal bar code: | AATGGTCGAAGTACGCTATTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 775 |
| LEAP-Seq percent confirming: | 55.2381 |
| LEAP-Seq n confirming: | 348 |
| LEAP-Seq n nonconfirming: | 282 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAACAAACACCACCATCAC |
| Suggested primer 2: | TGCACAAGCTCCTCAATCAC |