| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.130669 |
| Chromosome: | chromosome 8 |
| Location: | 4403429 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g381950 | YAK1,TAR1 | (1 of 1) K18670 - dual specificity protein kinase YAK1 [EC:2.7.12.1] (YAK1); DYRK-type protein kinase/Yet-another-kinase 1 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAAATCTCTGGACGGCGGCTGGCCGGCCG |
| Internal bar code: | TAGAGCATTCTGTCTCATATTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 379 |
| LEAP-Seq percent confirming: | 83.0822 |
| LEAP-Seq n confirming: | 8658 |
| LEAP-Seq n nonconfirming: | 1763 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCGCAGTTCATGCAGTTTG |
| Suggested primer 2: | GACTTACTTCGGCGCTTTTG |