| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.130674 |
| Chromosome: | chromosome 3 |
| Location: | 2571949 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g160400 | SAC1 | (1 of 1) IPR001898//IPR004680//IPR006037//IPR029062 - Sodium/sulphate symporter // Citrate transporter-like domain // Regulator of K+ conductance, C-terminal // Class I glutamine amidotransferase-like; Sulfur acclimation 1 protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAAAAGCAAAGCCCGGCACACACGGTTCAC |
| Internal bar code: | CTTTACACGGTGTTCCACACGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 362 |
| LEAP-Seq percent confirming: | 99.7185 |
| LEAP-Seq n confirming: | 3896 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGGGTCTGTAATCCTCGTA |
| Suggested primer 2: | CATGAGCAAGAGCTAGCGTG |