Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.130675 |
Chromosome: | chromosome 11 |
Location: | 3226428 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g479600 | MHX1,CAX6 | (1 of 1) K05849 - solute carrier family 8 (sodium/calcium exchanger) (SLC8A, NCX); putative Ca2+/Na+ exchanger | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTTTCAACACACGCGCTCCTGTGCGCCCC |
Internal bar code: | GCCAATCCGAAACAGCAATTCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 291 |
LEAP-Seq percent confirming: | 98.7919 |
LEAP-Seq n confirming: | 2535 |
LEAP-Seq n nonconfirming: | 31 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTCCTTTCTTCACTGGCAC |
Suggested primer 2: | TAGCCCTACTGCCTGATGCT |