Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.130718 |
Chromosome: | chromosome 12 |
Location: | 8854411 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g544750 | (1 of 1) PF13637//PF13857 - Ankyrin repeats (many copies) (Ank_4) // Ankyrin repeats (many copies) (Ank_5) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGAAACGGCGGTGGCAGTACGGCACACGC |
Internal bar code: | GTGACTGGTCCAGCGCACACCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 295 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 66 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGTGCCTGCATCACCTGT |
Suggested primer 2: | GAGGAGTTGGAGGTCTGTGC |