Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.130822 |
Chromosome: | chromosome 17 |
Location: | 3394045 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g723950 | FAP397 | Flagellar Associated Protein 397 with UDP-galactose 4-epimerase domain | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGAGGGTGCGAGCTCGCAGTGAGCGACTT |
Internal bar code: | TGCGTTTGACCCATCATAGGAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1399 |
LEAP-Seq percent confirming: | 97.3672 |
LEAP-Seq n confirming: | 12241 |
LEAP-Seq n nonconfirming: | 331 |
LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CACCCCAGAACCCAAGAGTA |
Suggested primer 2: | TACAGCACGAACAGTCGAGG |