| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.130849 |
| Chromosome: | chromosome 8 |
| Location: | 1902373 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g367200 | VPS52 | (1 of 1) PF04129 - Vps52 / Sac2 family (Vps52); Subunit of GARP complex | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCAGCGGTGGGAGCCTTGCAGAGGGTTCA |
| Internal bar code: | TATGCAGGTTCTGATAGGCCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1058 |
| LEAP-Seq percent confirming: | 99.621 |
| LEAP-Seq n confirming: | 23393 |
| LEAP-Seq n nonconfirming: | 89 |
| LEAP-Seq n unique pos: | 100 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTATACACCGCCTACCCAGC |
| Suggested primer 2: | ATTGCTATCCAACGCGTACC |