Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.130849 |
Chromosome: | chromosome 8 |
Location: | 1902422 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g367200 | VPS52 | (1 of 1) PF04129 - Vps52 / Sac2 family (Vps52); Subunit of GARP complex | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGCTCTACCTCCTGCTCCTCATATCCTGA |
Internal bar code: | TTGTTAATAATACCGTCGGGTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 559 |
LEAP-Seq percent confirming: | 99.4534 |
LEAP-Seq n confirming: | 13464 |
LEAP-Seq n nonconfirming: | 74 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTATACACCGCCTACCCAGC |
Suggested primer 2: | ATTGCTATCCAACGCGTACC |