Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.130963 |
Chromosome: | chromosome 1 |
Location: | 4522453 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g030800 | CSN2 | COP9 signalosome subunit; (1 of 1) K12176 - COP9 signalosome complex subunit 2 (COPS2, CSN2, TRIP15) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCCGACGCAATTACTCGTGTCAGCACGCT |
Internal bar code: | TGCGCATGGGGGCTGAGGGACA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1005 |
LEAP-Seq percent confirming: | 99.287 |
LEAP-Seq n confirming: | 1114 |
LEAP-Seq n nonconfirming: | 8 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGCATACGTGATCCAATGAC |
Suggested primer 2: | AGTTTTGGAGGTACATGGCG |