| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.131004 |
| Chromosome: | chromosome 17 |
| Location: | 1522703 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g707200 | LIC2 | (1 of 5) PF02931 - Neurotransmitter-gated ion-channel ligand binding domain (Neur_chan_LBD); Ligand-gated ion channel | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTGGTTGCCGGGTCAACTTGGCAAATGGC |
| Internal bar code: | CAAAGACGTTGGTGCGTTCGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 876 |
| LEAP-Seq percent confirming: | 98.4779 |
| LEAP-Seq n confirming: | 9058 |
| LEAP-Seq n nonconfirming: | 140 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACGCCGGACAATACTCAAC |
| Suggested primer 2: | GCCTGTGTGTACATGCTGCT |