| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.131005 |
| Chromosome: | chromosome 9 |
| Location: | 3305911 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g388282 | bS18m,MRPS18 | Mitochondrial ribosomal protein S18; (1 of 2) PF01084 - Ribosomal protein S18 (Ribosomal_S18) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCTGTGCGCGCAATACTGGTTGAAACAGA |
| Internal bar code: | TTGGACTAGCTTTAAGGTGGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 508 |
| LEAP-Seq percent confirming: | 97.9321 |
| LEAP-Seq n confirming: | 3978 |
| LEAP-Seq n nonconfirming: | 84 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGCGAAAGTCGTCTCCTGA |
| Suggested primer 2: | CAGTGTGCTGCAATCATGTG |