| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.131145 |
| Chromosome: | chromosome 5 |
| Location: | 647969 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g231050 | (1 of 1) K10636 - autocrine motility factor receptor (AMFR, GP78) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCAGGTTAGGTGGAGGAGTCAAGCCAGGT |
| Internal bar code: | CTAACCGCGGGCGACTACGTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 510 |
| LEAP-Seq percent confirming: | 99.7527 |
| LEAP-Seq n confirming: | 18558 |
| LEAP-Seq n nonconfirming: | 46 |
| LEAP-Seq n unique pos: | 64 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCTATCTCGCCGTACCAGC |
| Suggested primer 2: | CGCTGCCTCTTATCCTGAAC |