| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.131155 |
| Chromosome: | chromosome 10 |
| Location: | 3257874 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g443100 | (1 of 1) IPR001214//IPR023220 - SET domain // Type IV secretion system, VirB5-domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCACCAACAAGGCACTAAGCAATTACGGT |
| Internal bar code: | GGGCTCTTCTCTTAACGAGCAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 933 |
| LEAP-Seq percent confirming: | 99.5996 |
| LEAP-Seq n confirming: | 9951 |
| LEAP-Seq n nonconfirming: | 40 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAGCCCAAACTAAACCAAA |
| Suggested primer 2: | GCGTGTGCTTCTGATCATGT |