| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.131166 |
| Chromosome: | chromosome 8 |
| Location: | 2370766 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g370850 | UBC18,RCE1 | RUB1/NEDD8 E2 conjugating enzyme; (1 of 1) K10579 - ubiquitin-conjugating enzyme E2 M (UBE2M, UBC12) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTCATGGGCAACGGCCAGAGTACCGGTAT |
| Internal bar code: | GCCGGCGATGCCGTAATGGCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 919 |
| LEAP-Seq percent confirming: | 99.6287 |
| LEAP-Seq n confirming: | 8855 |
| LEAP-Seq n nonconfirming: | 33 |
| LEAP-Seq n unique pos: | 51 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTGTGAATGTAACCGGTCC |
| Suggested primer 2: | GATCGCTATCTTGATCCCCA |