| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.131205 |
| Chromosome: | chromosome 16 |
| Location: | 4874030 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g685900 | PRM3,PRMT3 | Protein arginine N-methyltransferase; (1 of 1) K11436 - protein arginine N-methyltransferase 3 [EC:2.1.1.-] (PRMT3) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACTTCGTATGCTGCGCAGCACGCCACCCA |
| Internal bar code: | ACCGCGCCGTGGAGTCAAGCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 287 |
| LEAP-Seq percent confirming: | 93.882 |
| LEAP-Seq n confirming: | 2578 |
| LEAP-Seq n nonconfirming: | 168 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGAATGACAGACTGAGCGG |
| Suggested primer 2: | TATAGGACCCTCGCCTCCTT |