Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.131208 |
Chromosome: | chromosome 12 |
Location: | 450956 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g493550 | THK3 | Thymidine kinase; (1 of 1) PTHR11652//PTHR11652:SF1 - 30S RIBOSOMAL PROTEIN S12 FAMILY MEMBER // 28S RIBOSOMAL PROTEIN S12, MITOCHONDRIAL | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGCTGGGGTGGTGGTGCTGGGGTGCGGGC |
Internal bar code: | CCAATGCACTACCGTGCACTGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 88 |
LEAP-Seq percent confirming: | 46.962 |
LEAP-Seq n confirming: | 371 |
LEAP-Seq n nonconfirming: | 419 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCGCACATACACATACACCC |
Suggested primer 2: | CATGCCCCTTTTGTTTCTGT |