Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.131349 |
Chromosome: | chromosome 10 |
Location: | 6433818 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g465950 | CGL148 | Conserved in the Green Lineage; (1 of 1) K12846 - U4/U6.U5 tri-snRNP-associated protein 3 (SNRNP27) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGTGGAAGTCGCTGTGCGGGGTGGACGCT |
Internal bar code: | GTTAGTCTGTCGTCCTTTTCAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 93 |
LEAP-Seq percent confirming: | 7.14137 |
LEAP-Seq n confirming: | 344 |
LEAP-Seq n nonconfirming: | 4473 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGACTACCACGAGAGGGACA |
Suggested primer 2: | TAAACACGCGTTATGGGTGA |