| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.131356 |
| Chromosome: | chromosome 7 |
| Location: | 1525167 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g324050 | CUL1,CUL3 | Ubiquitin ligase SCF complex subunit Cullin; (1 of 1) K03869 - cullin 3 (CUL3) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACATTTTAAAGCTTTGATGTCCTCCAGCGT |
| Internal bar code: | TTAGCATTTTTTGGTGAATCAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1175 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 667 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTCAGGCGGTCTTCTACTG |
| Suggested primer 2: | TGAAAGCAATGGGTGACGTA |