Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.131361 |
Chromosome: | chromosome 6 |
Location: | 7347592 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g298950 | (1 of 2) PF10343 - Potential Queuosine, Q, salvage protein family (Q_salvage) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGCCCCACAGCCTTCCGCACAATCCGCAG |
Internal bar code: | GGACCGCTTCCTCTTATCTACC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 581 |
LEAP-Seq percent confirming: | 99.6084 |
LEAP-Seq n confirming: | 2035 |
LEAP-Seq n nonconfirming: | 8 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AATGCGTGTTGAAGGGAAAG |
Suggested primer 2: | ATTGGAACAAACAACCCCAA |