| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.131415 |
| Chromosome: | chromosome 17 |
| Location: | 2698396 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g717950 | PHC28,PHC6 | (1 of 24) IPR003882//IPR024616 - Pistil-specific extensin-like protein // Pherophorin; Pherophorin-chlamydomonas homolog 6 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTAGGTCACTAGACTTAACGCCACATCTTG |
| Internal bar code: | TCTTTTTCCCGCTTTCTGGATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 612 |
| LEAP-Seq percent confirming: | 99.5583 |
| LEAP-Seq n confirming: | 5409 |
| LEAP-Seq n nonconfirming: | 24 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCTACTGCTTTGAGCTGGC |
| Suggested primer 2: | CGGGCTTACTTGCTTGAGTC |