Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.131428 |
Chromosome: | chromosome 5 |
Location: | 2233860 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g234659 | MRPL30,uL30m | (1 of 1) K02907 - large subunit ribosomal protein L30 (RP-L30, MRPL30, rpmD); Mitochondrial ribosomal protein L30 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCAAGTCTGGAGGACCGACCGGCCTAGTG |
Internal bar code: | GAGGCTACTTGGGTGCTAGAGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 393 |
LEAP-Seq percent confirming: | 99.6895 |
LEAP-Seq n confirming: | 2890 |
LEAP-Seq n nonconfirming: | 9 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCCTGCTCACACAAAGTTGA |
Suggested primer 2: | TGGGTTTCCAAGGAGAACAG |