| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.131508 |
| Chromosome: | chromosome 2 |
| Location: | 5863421 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g111300 | (1 of 5) PF13391 - HNH endonuclease (HNH_2) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAGGAAGGTTTCGTGGAAAGGACACGGAC |
| Internal bar code: | TGGTGTGTTTAACTGCATTTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1067 |
| LEAP-Seq percent confirming: | 98.4291 |
| LEAP-Seq n confirming: | 2569 |
| LEAP-Seq n nonconfirming: | 41 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGCGCTAGAATCAAAGAAC |
| Suggested primer 2: | CCCCGGTCTACCTGTACTGA |