| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.131522 |
| Chromosome: | chromosome 6 |
| Location: | 5236500 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g282250 | NAT18 | N-acetyltransferase; (1 of 1) 2.3.1.48//2.3.1.88 - Histone acetyltransferase // Peptide alpha-N-acetyltransferase / Protein N-terminal acetyltransferase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGCCGGTACTCGTACGACACGCCCAGGTA |
| Internal bar code: | GTCGGCACGGACCAACAGAGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 69 |
| LEAP-Seq percent confirming: | 94.2857 |
| LEAP-Seq n confirming: | 66 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTTCCACCTCCTCCTCCTC |
| Suggested primer 2: | CCCGCTGTGTACATGTTGTC |