Insertion junction: LMJ.RY0402.131526_1

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:-
Strain:LMJ.RY0402.131526
Chromosome:chromosome_6
Location:8991640
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre06.g311700 sense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):CCCACCTCTGCCCAAGTCAGTGGCGCAAGC
Internal bar code:CGAAGGCTCCATCTTTCACGTA

Confirmation - LEAP-Seq

LEAP-Seq distance:837
LEAP-Seq percent confirming:99.4629
LEAP-Seq n confirming:3889
LEAP-Seq n nonconfirming:21
LEAP-Seq n unique pos:8

Suggested primers for confirmation by PCR

Suggested primer 1:ACTGTTCACAGGCTGACACG
Suggested primer 2:TTCTCGTCTGAGCAACATGG