Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.131560 |
Chromosome: | chromosome 2 |
Location: | 6817902 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g119050 | CER1 | Carboxyesterase-related protein; (1 of 2) K15889 - prenylcysteine alpha-carboxyl methylesterase (PCME) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCTACATAACAGGCAGGTGCTCATCGGCA |
Internal bar code: | CAGATTCTGTTACTCCCTTGTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 773 |
LEAP-Seq percent confirming: | 99.4924 |
LEAP-Seq n confirming: | 196 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CATAATTCGGTCCAGCAGGT |
Suggested primer 2: | GTCGTACATTTGCGGGAGTT |