| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.131591 |
| Chromosome: | chromosome 8 |
| Location: | 2553119 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g372400 | UBC19 | E2 Ubiquitin conjugating enzyme; (1 of 1) K04554 - ubiquitin-conjugating enzyme E2 J2 (UBE2J2, NCUBE2, UBC6) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGTGTTGATCCCGCCGTCCGCCATGCACC |
| Internal bar code: | GCGCTGATTCGGGTACTGAGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 409 |
| LEAP-Seq percent confirming: | 95.6391 |
| LEAP-Seq n confirming: | 6996 |
| LEAP-Seq n nonconfirming: | 319 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCCCAAGCAGACAACAAAC |
| Suggested primer 2: | TGGGTGGTGTACTGGTGTTG |