| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.131593 |
| Chromosome: | chromosome 13 |
| Location: | 268278 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g563850 | PRORP1,PRORP | (1 of 1) K18213 - proteinaceous RNase P (PRORP); Protein-only RNase P | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGGTGAACAGCATTTCTTGCAGATGCTA |
| Internal bar code: | GTCGCGAGGGACATGCACTTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 488 |
| LEAP-Seq percent confirming: | 99.5863 |
| LEAP-Seq n confirming: | 3611 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTGTTGACTTTGACCGCCT |
| Suggested primer 2: | ATATCCCACAGCGCAGTACC |