| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.131640 |
| Chromosome: | chromosome 16 |
| Location: | 2154008 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g658200 | (1 of 2) IPR003594//IPR024975 - Histidine kinase-like ATPase, C-terminal domain // Domain of unknown function DUF3883 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCGCCACCGCACCCTGACGACAGCAGGAG |
| Internal bar code: | GAATTCAGGCCGACCCACGGTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 553 |
| LEAP-Seq percent confirming: | 81.2364 |
| LEAP-Seq n confirming: | 26163 |
| LEAP-Seq n nonconfirming: | 6043 |
| LEAP-Seq n unique pos: | 78 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACGCATATATTCACGCACC |
| Suggested primer 2: | ATGCCAAAGAGCGAAGACAC |