| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.131679 |
| Chromosome: | chromosome 7 |
| Location: | 4211159 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g342050 | NPSN1,VTI3 | (1 of 1) K08494 - novel plant SNARE (NSPN); Endosomal Qb-SNARE, Npsn-family (plant/protist-specific) (Qb.III.d) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAATGGCTCTCGGACCATGTGACGAGTGC |
| Internal bar code: | GATTGGACCCCAAGACCCGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 911 |
| LEAP-Seq percent confirming: | 97.1611 |
| LEAP-Seq n confirming: | 4107 |
| LEAP-Seq n nonconfirming: | 120 |
| LEAP-Seq n unique pos: | 36 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCCACTCAAACCTTTCGTA |
| Suggested primer 2: | GTCTGAAGCGGCAAATAAGC |