| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.131702 |
| Chromosome: | chromosome 6 |
| Location: | 3698174 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g278143 | GAE,GAE4 | (1 of 1) 5.1.3.6 - UDP-glucuronate 4-epimerase / Uridine diphosphoglucuronate epimerase; UDP-D-glucuronate 4-epimerase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGACAATCGACGGCATGCATTGATTTTGCG |
| Internal bar code: | TGTATTGAGGGCTCCCGGCGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 110 |
| LEAP-Seq percent confirming: | 99.4382 |
| LEAP-Seq n confirming: | 177 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTAGCTCCCGCCTTCTTTT |
| Suggested primer 2: | GGGAGTGTGAGAGCAGGAAG |