Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.131782 |
Chromosome: | chromosome 12 |
Location: | 6237967 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g536900 | (1 of 1) IPR000104//IPR003072//IPR003495//IPR011629//IPR012336//IPR027417 - Antifreeze protein, type I // Orphan nuclear receptor, NOR1 type // CobW/HypB/UreG domain // Cobalamin (vitamin B12) biosynthesis CobW-like, C-terminal // Thioredoxin-like fold // P-loop containing nucleoside triphosphate hydrolase; Putative metallochaperone | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGCCGACTGGCGCCTCTCCCCACTCCCT |
Internal bar code: | GGGGTCTGGTTTCGCTTGCATT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 256 |
LEAP-Seq percent confirming: | 99.5848 |
LEAP-Seq n confirming: | 1919 |
LEAP-Seq n nonconfirming: | 8 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATTGGGCTCAGTTTGGTTTG |
Suggested primer 2: | TGGACCGTCTACCATTTCCT |