Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.131784 |
Chromosome: | chromosome 12 |
Location: | 3956507 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g516450 | CAG1 | Gamma carbonic anhydrase 1; (1 of 1) PTHR13061//PTHR13061:SF7 - DYNACTIN SUBUNIT P25 // SUBFAMILY NOT NAMED | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTGCAGCCCCATCGCAACGTTGCTTTCCA |
Internal bar code: | ACTCGTTGCAGGCATCCAGCCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 799 |
LEAP-Seq percent confirming: | 99.1303 |
LEAP-Seq n confirming: | 7865 |
LEAP-Seq n nonconfirming: | 69 |
LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTTGCGTTGAAGATGCTGTC |
Suggested primer 2: | AACAGCTCCGTTTGGTATGG |