| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.131843 |
| Chromosome: | chromosome 12 |
| Location: | 1364272 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g488400 | KATL5 | katanin like protein 5, similar to the catalytic subunit; (1 of 9) 3.6.4.3 - Microtubule-severing ATPase / Katanin | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTGGCGCAGAAGCATGTCCGCACAGATGC |
| Internal bar code: | GTAGGATCGCGGTTGTTAGGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 767 |
| LEAP-Seq percent confirming: | 99.4654 |
| LEAP-Seq n confirming: | 3721 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATATTCACGTGTGAACGCC |
| Suggested primer 2: | TCCACCTCGTCCTGATTTTC |