| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.131862 |
| Chromosome: | chromosome 16 |
| Location: | 2137698 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g658075 | (1 of 1) K13987 - ADP-sugar pyrophosphatase / 8-oxo-dGDP phosphatase (NUDT5) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCACAGGCGGGGGCGCGGGTGCCGCTGGTG |
| Internal bar code: | CGTCGAGTTACGAATGATCTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1035 |
| LEAP-Seq percent confirming: | 97.1762 |
| LEAP-Seq n confirming: | 3579 |
| LEAP-Seq n nonconfirming: | 104 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGCACTTAACGCCTCAGTT |
| Suggested primer 2: | TCGTCTACACAGCTCATCCG |