Insertion junction: LMJ.RY0402.131969_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.131969
Chromosome:chromosome_6
Location:1200028
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre06.g257600 FA1 Flagellar Autonomy Protein antisense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):AGCATTGCGCCACCGCCGGCAGCAGATCAT
Internal bar code:TCAGAGGCCGGATGTTAAGTGA

Confirmation - LEAP-Seq

LEAP-Seq distance:618
LEAP-Seq percent confirming:92.0794
LEAP-Seq n confirming:8533
LEAP-Seq n nonconfirming:734
LEAP-Seq n unique pos:48

Suggested primers for confirmation by PCR

Suggested primer 1:CCATGCATTGACCATCAGTC
Suggested primer 2:TACATTGACCCGCTCACATC