Insertion junction: LMJ.RY0402.131969_2

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:-
Strain:LMJ.RY0402.131969
Chromosome:chromosome_6
Location:1200031
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre06.g257600 FA1 Flagellar Autonomy Protein antisense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):TACTTGTTTTTGCAGGGCGGAGCTGTCTGC
Internal bar code:CCGGCTTTTACCGAACGCGAG

Confirmation - LEAP-Seq

LEAP-Seq distance:466
LEAP-Seq percent confirming:100.0
LEAP-Seq n confirming:1
LEAP-Seq n nonconfirming:0
LEAP-Seq n unique pos:1

Suggested primers for confirmation by PCR

Suggested primer 1:CCATGCATTGACCATCAGTC
Suggested primer 2:TACATTGACCCGCTCACATC