| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.132040 |
| Chromosome: | chromosome 7 |
| Location: | 2575806 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g329900 | COP8,HKR4,COP | (1 of 1) PF00072//PF00211//PF00512//PF01036//PF02518//PF07647 - Response regulator receiver domain (Response_reg) // Adenylate and Guanylate cyclase catalytic domain (Guanylate_cyc) // His Kinase A (phospho-acceptor) domain (HisKA) // Bacteriorhodopsin-like protein (Bac_rhodopsin) // Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase (HATPase_c) // SAM domain (Sterile alpha motif) (SAM_2); Histidine kinase rhodopsin 4 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGATAAAAAATCACAAATTTAAAGTGGCG |
| Internal bar code: | TTGCCGAACGTAATTCTTGTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 650 |
| LEAP-Seq percent confirming: | 92.2987 |
| LEAP-Seq n confirming: | 2361 |
| LEAP-Seq n nonconfirming: | 197 |
| LEAP-Seq n unique pos: | 33 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTTTCTTTCGTTTCTTCGC |
| Suggested primer 2: | CACGTTCCTTCCTTCTCTGC |