Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.132083 |
Chromosome: | chromosome 12 |
Location: | 7757312 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g553800 | (1 of 1) IPR002110//IPR020683//IPR029071 - Ankyrin repeat // Ankyrin repeat-containing domain // Ubiquitin-related domain | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTGCCTCGAGCAAACCGCCACGCATACCA |
Internal bar code: | TCAACATCGCCTTTCACGCACC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 348 |
LEAP-Seq percent confirming: | 95.9593 |
LEAP-Seq n confirming: | 19046 |
LEAP-Seq n nonconfirming: | 802 |
LEAP-Seq n unique pos: | 57 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAGTACGGCGACTTCTACGC |
Suggested primer 2: | CAACGACTGGTACGGCAAC |