| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.132086 |
| Chromosome: | chromosome 6 |
| Location: | 1150617 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g257150 | RPL37a,RPL37A | Cytosolic 80S ribosomal protein L37a; (1 of 1) K02921 - large subunit ribosomal protein L37Ae (RP-L37Ae, RPL37A) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGCCCATTTCACACCAGCCAAGCACAGCA |
| Internal bar code: | GTAGGGATGCAGCGATGGCTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1 |
| LEAP-Seq percent confirming: | 99.6026 |
| LEAP-Seq n confirming: | 2005 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGGCAGCAGGTATTCATTA |
| Suggested primer 2: | CTACTGCCCTGACTGCCTTC |