Insertion junction: LMJ.RY0402.132101_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.132101
Chromosome:chromosome_16
Location:1435243
Confidence (%):58
Locus disrupted Locus common name Defline Orientation Feature
Cre16.g652400 FAL18 Similar to Flagellar Associated Protein FAP183 sense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):CTGCGCGGCTGCCGTATCACCCGCTGGCTC
Internal bar code:CAGGTGTGGGAGGATGTACCGT

Confirmation - LEAP-Seq

LEAP-Seq distance:231
LEAP-Seq percent confirming:99.6
LEAP-Seq n confirming:249
LEAP-Seq n nonconfirming:1
LEAP-Seq n unique pos:3

Suggested primers for confirmation by PCR

Suggested primer 1:ATACCAATACCTCTGCCCCC
Suggested primer 2:ATGTATTTGCTCCCCGTGTC