| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.132124 |
| Chromosome: | chromosome 17 |
| Location: | 6016465 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g740800 | (1 of 5) PF06742//PF06863 - Protein of unknown function (DUF1214) (DUF1214) // Protein of unknown function (DUF1254) (DUF1254) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGGCTGTTCGCGGAGGTTTCTGACACAGA |
| Internal bar code: | TGCTGCCCCGGTCAAGAAGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 56 |
| LEAP-Seq percent confirming: | 0.961538 |
| LEAP-Seq n confirming: | 42 |
| LEAP-Seq n nonconfirming: | 4326 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGGATTTCGAAGGGAATGA |
| Suggested primer 2: | TGCTCAGGGTCAGCTAGGTT |