| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.132193 |
| Chromosome: | chromosome 2 |
| Location: | 5467905 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g107850 | MOB1 | (1 of 1) K06685 - MOB kinase activator 1 (MOB1, Mats); Cytokinesis-related protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTACGGTAGATGCATTGCCCCGCCTCGCAT |
| Internal bar code: | CGGGGTTTCGAGTGAGTTACCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 718 |
| LEAP-Seq percent confirming: | 97.0269 |
| LEAP-Seq n confirming: | 2415 |
| LEAP-Seq n nonconfirming: | 74 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTCATCGATGTTGCTCTGA |
| Suggested primer 2: | ACTCAACTGGGCAATAACGG |