| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.132312 |
| Chromosome: | chromosome 2 |
| Location: | 5802345 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g110850 | (1 of 8) IPR000719//IPR001245//IPR011009 - Protein kinase domain // Serine-threonine/tyrosine-protein kinase catalytic domain // Protein kinase-like domain | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCTCATGCAAAAATCTTCTCGCTCTGGCT |
| Internal bar code: | CTCAAGTTGCCCTTTCAAGAAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 756 |
| LEAP-Seq percent confirming: | 99.6325 |
| LEAP-Seq n confirming: | 2169 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATCCCCATCGGTCATAAAC |
| Suggested primer 2: | AAACCCGCTTCTTACCCTGT |